pCD002
(Plasmid
#113313)
-
PurposeRFP and GFP reporter genes
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneR6K vector
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfGFP and mRFP
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATTATTAACAGCGCCCGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid must be grown in a pir+ bacterial strain in order to replicate.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCD002 was a gift from Jesse Zalatan (Addgene plasmid # 113313) -
For your References section:
Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria. Dong C, Fontana J, Patel A, Carothers JM, Zalatan JG. Nat Commun. 2018 Jun 27;9(1):2489. doi: 10.1038/s41467-018-04901-6. 10.1038/s41467-018-04901-6 PubMed 29950558