pAW-AlphaLobe
(Plasmid #113255)

• Purpose: E. coli expression vector for His-MBP-Cas9 Alpha-Helical Lobe
• Depositing Lab: Jennifer Doudna
• Publication: Wright et al Proc Natl Acad Sci U S A. 2015 Mar 10;112(10):2984-9. doi: 10.1073/pnas.1501698112. Epub 2015 Feb 23.

Backbone

• Vector backbone: 2CT
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7949
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: S. pyogenes Cas9 alpha-helical lobe
• Species: S. pyogenes
• Insert Size (bp): 2091
• Mutation: residues 56–714; See paper for description
• GenBank ID: NC_002737.2
• Promoter: T7
• Tag / Fusion Protein:
  • 10xHis-MBP (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGCGGTCGTCAGACTGTCG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • Alpha_helical_lobe_2CT10xHis.gb
• A portion of this plasmid was derived from a plasmid made by: Sam Sternberg, Doudna lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry