pAW-SpyCas1
(Plasmid #113248)

• Purpose: E. coli expression vector for His-MBP-S. pyogenes Cas1
• Depositing Lab: Jennifer Doudna
• Publication: Wright et al Nat Struct Mol Biol. 2016 Oct;23(10):876-883. doi: 10.1038/nsmb.3289. Epub 2016 Sep 5.

Backbone

• Vector backbone: pET16bMBP
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7734
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: S. pyogenes Cas1
• Alt name: SpyCas1
• Species: S. pyogenes
• Insert Size (bp): 870
• GenBank ID: NC_002737.2
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis-MBP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CAGCGGTCGTCAGACTGTCG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pET16MBPdS SpyCas1.gb
• A portion of this plasmid was derived from a plasmid made by: James Nuñez, Doudna Lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry