pAW218
(Plasmid
#113240)
-
PurposeE. coli expression vector for untagged E. coli Cas1 + Cas2 with CRISPR array, leader IHF binding site flip
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDF1b
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4909
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas1
-
SpeciesE. coli
-
Insert Size (bp)924
Gene/Insert 2
-
Gene/Insert nameCas2
-
SpeciesE. coli
-
Insert Size (bp)285
Gene/Insert 3
-
Gene/Insert nameLeader-repeat
-
SpeciesE. coli
-
Insert Size (bp)154
-
MutationAAAAAATCATTAATTAATAATAGGTTATG->CATAACCTATTATTAATTAATGATTTTTT (IHF binding site flip)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW218 was a gift from Jennifer Doudna (Addgene plasmid # 113240 ; http://n2t.net/addgene:113240 ; RRID:Addgene_113240) -
For your References section:
Structures of the CRISPR genome integration complex. Wright AV, Liu JJ, Knott GJ, Doxzen KW, Nogales E, Doudna JA. Science. 2017 Sep 15;357(6356):1113-1118. doi: 10.1126/science.aao0679. Epub 2017 Jul 20. 10.1126/science.aao0679 PubMed 28729350