Skip to main content
Addgene

pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
(Plasmid #113158)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113158 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pOTTC407
  • Backbone manufacturer
    NIDA OTTC
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6826
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    gRNA for rat TH
  • gRNA/shRNA sequence
    ACGGCCCTTCTGAAGCCCTT
  • Species
    R. norvegicus (rat)
  • Promoter mU6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP was a gift from Brandon Harvey (Addgene plasmid # 113158 ; http://n2t.net/addgene:113158 ; RRID:Addgene_113158)

  • For your References section:

    Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150
Related items:
Commonly requested with: