pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP
(Plasmid
#113155)
-
PurposeAn AAV vector that expresses guide RNAs targeting rat TH and expresses EGFP reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepOTTC407
-
Backbone manufacturerNIDA OTTC
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6981
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTwo gRNAs for rat TH
-
gRNA/shRNA sequenceACGGCCCTTCTGAAGCCCTT and AGGCCGAGGCTGTCACGGTG
-
SpeciesR. norvegicus (rat)
- Promoter mU6 and hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTCGCACAGACTTGTGGGA
- 3′ sequencing primer AAATGGACTATCATATGCTTACCGTAACTTGAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1088 - pAAV TH gRNA A+B pair EF1a EGFP was a gift from Brandon Harvey (Addgene plasmid # 113155 ; http://n2t.net/addgene:113155 ; RRID:Addgene_113155) -
For your References section:
Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150