Dppa1-T2A-H2B-Halo donor
(Plasmid
#113118)
-
PurposeDonor plasmid for knock-in T2A-H2B-Halo to the c-terminal of mouse Dppa1 coding sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113118 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepbluescript
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDppa1 donor region including homology arms and T2A-H2B-Halo
-
SpeciesM. musculus (mouse), Synthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACACAGGAAACAGCTATGAC
- 3′ sequencing primer CGCAACTGTTGGGAAGGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Dppa1-T2A-H2B-Halo donor was a gift from Janet Rossant (Addgene plasmid # 113118 ; http://n2t.net/addgene:113118 ; RRID:Addgene_113118) -
For your References section:
Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212