Skip to main content
Addgene

Gata4-GFP donor
(Plasmid #113115)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113115 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pbluescript
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gata4 donor region including homology arms and eGFP
  • Species
    M. musculus (mouse), Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACACAGGAAACAGCTATGAC
  • 3′ sequencing primer CGCAACTGTTGGGAAGGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Gata4-GFP donor was a gift from Janet Rossant (Addgene plasmid # 113115 ; http://n2t.net/addgene:113115 ; RRID:Addgene_113115)
  • For your References section:

    Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Gu B, Posfai E, Rossant J. Nat Biotechnol. 2018 Jun 11. pii: nbt.4166. doi: 10.1038/nbt.4166. 10.1038/nbt.4166 PubMed 29889212