PAK4-FL-3'UTR-MT2
(Plasmid
#113093)
-
PurposeLuciferase reporter containing PAK4-FL- 3' UTR with the second predicted MiR-199a-3p binding site mutated
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmirGLO Dual-Luciferase
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7350
- Total vector size (bp) 7856
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep21 Activated kinase 4
-
Alt namePAK4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)507
-
MutationSecond predicted miR-199a-3p binding site mutated by substitution of 4 bases
-
GenBank IDNM_001014834.2 NM_001014834.2
-
Entrez GenePAK4
- Promoter PGK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site DraI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer ACACGGTAAAACCATGAC
- 3′ sequencing primer GTCCAAACTCATCAATGTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Oligos used for site-directed mutagenesis
Forward:
CCCCTGCAGCAAATGACTGACACACCTGGACAGCCTCCTC
Reverse:
GAGGAGGCTGTCCAGGTGTGTCAGTCATTTGCTGCAGGGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PAK4-FL-3'UTR-MT2 was a gift from James Donahue (Addgene plasmid # 113093 ; http://n2t.net/addgene:113093 ; RRID:Addgene_113093) -
For your References section:
MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4. Phatak P, Burrows WM, Chesnick IE, Tulapurkar ME, Rao JN, Turner DJ, Hamburger AW, Wang JY, Donahue JM. Oncotarget. 2018 Jun 19;9(47):28391-28407. doi: 10.18632/oncotarget.25375. eCollection 2018 Jun 19. 10.18632/oncotarget.25375 PubMed 29983868