Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS414-ATG41
(Plasmid #113080)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113080 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS414
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ATG41
  • Alt name
    ICY2
  • Species
    S. cerevisiae (budding yeast)
  • GenBank ID
  • Promoter ATG41 endogenous promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ECOR1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer CTGCCTCTCGTCGTCATTAA
  • 3′ sequencing primer AGGTGCGTAAAAGATGTGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS414-ATG41 was a gift from Daniel Klionsky (Addgene plasmid # 113080 ; http://n2t.net/addgene:113080 ; RRID:Addgene_113080)
  • For your References section:

    Atg41/Icy2 regulates autophagosome formation. Yao Z, Delorme-Axford E, Backues SK, Klionsky DJ. Autophagy. 2015;11(12):2288-99. doi: 10.1080/15548627.2015.1107692. 10.1080/15548627.2015.1107692 PubMed 26565778