pRS414-ATG41
(Plasmid
#113080)
-
PurposeContain 1,000 nucleotides of the ATG41 5'UTR, the ATG41 open reading frame and 500 nucleotides of the 3' UTR.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS414
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameATG41
-
Alt nameICY2
-
SpeciesS. cerevisiae (budding yeast)
-
GenBank ID
- Promoter ATG41 endogenous promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ECOR1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer CTGCCTCTCGTCGTCATTAA
- 3′ sequencing primer AGGTGCGTAAAAGATGTGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS414-ATG41 was a gift from Daniel Klionsky (Addgene plasmid # 113080 ; http://n2t.net/addgene:113080 ; RRID:Addgene_113080) -
For your References section:
Atg41/Icy2 regulates autophagosome formation. Yao Z, Delorme-Axford E, Backues SK, Klionsky DJ. Autophagy. 2015;11(12):2288-99. doi: 10.1080/15548627.2015.1107692. 10.1080/15548627.2015.1107692 PubMed 26565778