pTL2-IncB-GFP11x7
(Plasmid #113031)

• Purpose: Expresses IncB tagged with 7 copies of GFP11 under a tetracycline inducible promoter
• Depositing Lab: Kevin Hybiske
• Publication: Wang et al Pathog Dis. 2018 Mar 1;76(2). pii: 4830102. doi: 10.1093/femspd/fty011.

Backbone

• Vector backbone: pSW2
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: IncB
• Species: Chlamydia trachomatis
• Insert Size (bp): 345
• Entrez Gene: incB (a.k.a. CTL0484)
• Promoter: tet inducible
• Tags / Fusion Proteins:
  • GFP11x7 (C terminal on insert)
  • flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EagI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: TCGATTTTTGTGATGCTCGTCAG
• 3′ sequencing primer: CAATGTGCGCCATTTTTCACTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GFP11x7 sequence was obtained from Addgene plasmid #70224

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry