pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESneopA
(Plasmid
#112921)
-
PurposeGateway entry vector carrying human EF1a promoter-driven dCas9VP64-T2A-MS2p65HSF1 with Neomycin resistant marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENTR
- Backbone size w/o insert (bp) 2280
- Total vector size (bp) 11587
-
Vector typeMammalian Expression ; Gateway entry vector
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEF1a promoter, dCas9VP64, MS2p65HSF1, IRESneo
-
SpeciesSynthetic
-
Insert Size (bp)9307
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer ATGTAATTCTCCTTGGAATTTG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-EF1adCas9VP64_T2A_MS2p65HSF1-IRESneopA was a gift from Kosuke Yusa (Addgene plasmid # 112921 ; http://n2t.net/addgene:112921 ; RRID:Addgene_112921) -
For your References section:
Pooled extracellular receptor-ligand interaction screening using CRISPR activation. Chong ZS, Ohnishi S, Yusa K, Wright GJ. Genome Biol. 2018 Nov 26;19(1):205. doi: 10.1186/s13059-018-1581-3. 10.1186/s13059-018-1581-3 PubMed 30477585