pR_LG lenti-(empty)-del-CTS
(Plasmid #112895)

• Purpose: (Empty Backbone) Non-integrating lentiviral co-packaging plasmid designed to reduce multiple integrations and recombination during transduction of nucleic acid libraries
• Depositing Lab: Paul Blainey
• Publication: Feldman et al bioRxiv 262121

Backbone

• Vector backbone: pFUGW
• Backbone size (bp): 6976
• Modifications to backbone: dinucleotide substitution in 5' LTR to render virus non-integrating
• Vector type: Lentiviral
• Promoter: none

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tacatcaatgggcgtggata
• 3′ sequencing primer: atcgtttcagacccacctcc

Resource Information

• Supplemental Documents:
  • pr_lg-lenti-empty-del-cts

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pR_LG is a non-integrating lentiviral vector derived from lentiCas9-Blast by creating a 2 bp substitution in the 5' LTR and deleting the transgene and part of cPPT (deletion spans 5.9 kb from cPPT to U3PPT).

Please visit https://www.biorxiv.org/content/early/2018/02/08/262121 for bioRxiv preprint.