Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pScPPX2
(Plasmid #112877)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112877 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-15b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5708
  • Total vector size (bp) 6894
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PPX1
  • Alt name
    ScPPX
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1194
  • GenBank ID
    NP_012071.1
  • Entrez Gene
    PPX1 (a.k.a. YHR201C)
  • Promoter T7
  • Tag / Fusion Protein
    • 6X His tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid was originally constructed by Dr. Michael Gray in the lab of Dr. Ursula Jakob (University of Michigan).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScPPX2 was a gift from Michael Gray & Ursula Jakob (Addgene plasmid # 112877 ; http://n2t.net/addgene:112877 ; RRID:Addgene_112877)
  • For your References section:

    Polyphosphate is a primordial chaperone. Gray MJ, Wholey WY, Wagner NO, Cremers CM, Mueller-Schickert A, Hock NT, Krieger AG, Smith EM, Bender RA, Bardwell JC, Jakob U. Mol Cell. 2014 Mar 6;53(5):689-99. doi: 10.1016/j.molcel.2014.01.012. Epub 2014 Feb 20. 10.1016/j.molcel.2014.01.012 PubMed 24560923