pScPPX2
(Plasmid #112877)

• Purpose: Expresses His-tagged yeast exopolyphosphatase for purification from E. coli
• Depositing Labs: Michael Gray, Ursula Jakob
• Publication: Gray et al Mol Cell. 2014 Mar 6;53(5):689-99. doi: 10.1016/j.molcel.2014.01.012. Epub 2014 Feb 20.

Backbone

• Vector backbone: pET-15b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5708
• Total vector size (bp): 6894
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PPX1
• Alt name: ScPPX
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1194
• GenBank ID: NP_012071.1
• Entrez Gene: PPX1 (a.k.a. YHR201C)
• Promoter: T7
• Tag / Fusion Protein:
  • 6X His tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pScPPX2.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was originally constructed by Dr. Michael Gray in the lab of Dr. Ursula Jakob (University of Michigan).