pJY-RpABE-PDS3_IMS
(Plasmid
#112875)
-
Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in Arabidopsis
-
Depositing Labs
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepJY-RpABE
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameRPS5A promoter
-
gRNA/shRNA sequencecctccagatagctgcatgga
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1664
Gene/Insert 2
-
Gene/Insert nameABE7.10
-
gRNA/shRNA sequencecctccagatagctgcatgga
-
Speciesengineered
-
Insert Size (bp)5328
Gene/Insert 3
-
Gene/Insert nameU6-sgRNA targeting PDS3
-
gRNA/shRNA sequencecctccagatagctgcatgga
-
Insert Size (bp)548
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Induces mis-splicing at PDS3
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJY-RpABE-PDS3_IMS was a gift from Jin-Soo Kim & Jae-Young Yun (Addgene plasmid # 112875 ; http://n2t.net/addgene:112875 ; RRID:Addgene_112875) -
For your References section:
Precision genome engineering through adenine base editing in plants. Kang BC, Yun JY, Kim ST, Shin Y, Ryu J, Choi M, Woo JW, Kim JS. Nat Plants. 2018 Jun 4. pii: 10.1038/s41477-018-0178-x. doi: 10.1038/s41477-018-0178-x. 10.1038/s41477-018-0178-x [pii] PubMed 29867128
