rat APOBEC1 E63A
(Plasmid #112861)

• Purpose: plasmid for expression of a catalytically inactive rat APOBEC1 mutant in mammalian cells
• Depositing Lab: Silvestro Conticello
• Publication: Chieca et al bioRxiv 2021

Backbone

• Vector backbone: pEGFP-C3
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4727
• Total vector size (bp): 4627
• Modifications to backbone: the EGFP cds has been removed
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: APOBEC1
• Alt name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
• Species: R. norvegicus (rat)
• Insert Size (bp): 684
• Mutation: changed Glutamic acid 63 to Alanine
• GenBank ID: NM_012907
• Entrez Gene: Apobec1 (a.k.a. REPR, apobec-1)
• Promoter: CMV promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (unknown if destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • rat APOBEC1 E63A.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry