human ACF
(Plasmid #112860)

• Purpose: plasmid to overexpress human APOBEC1-complementation factor (ACF; A1CF) in mammalian cells
• Depositing Lab: Silvestro Conticello
• Publication: Chieca et al bioRxiv 2021

Backbone

• Vector backbone: pEGFP
• Backbone manufacturer: clontech
• Backbone size w/o insert (bp): 4727
• Total vector size (bp): 5706
• Modifications to backbone: the EGFP cds has been removed
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: APOBEC1 complementation factor
• Alt name: ACF
• Alt name: A1CF
• Species: H. sapiens (human)
• Insert Size (bp): 1761
• GenBank ID: NM_001198818 Gene ID: 29974
• Entrez Gene: A1CF (a.k.a. ACF, ACF64, ACF65, APOBEC1CF, ASP)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: none (unknown if destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • human ACF.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The ACF insert contains an L31S difference compared to the NP_055391.2 reference that is not of concern for function.