Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP mCherry-ApoB-EGFP
(Plasmid #112859)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5866
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-apoB-EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    1926
  • Promoter CMV promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
  • 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP mCherry-ApoB-EGFP was a gift from Silvestro Conticello (Addgene plasmid # 112859 ; http://n2t.net/addgene:112859 ; RRID:Addgene_112859)
  • For your References section:

    Flow-cytometric visualization of C>U mRNA editing reveals the dynamics of the process in live cells. Severi F, Conticello SG. RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033. 10.1080/15476286.2015.1026033 PubMed 25806564