pEGFP mCherry-ApoB-EGFP
(Plasmid #112859)

• Purpose: Plasmid bearing the editing target of APOBEC1 fused between the mCherry cds and the EGFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of EGFP
• Depositing Lab: Silvestro Conticello
• Publication: Severi et al RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5866
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry-apoB-EGFP
• Species: Synthetic
• Insert Size (bp): 1926
• Promoter: CMV promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • pEGFP-N1 mCherry-ApoB-EGFP.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry