rat APOBEC1-EGFP
(Plasmid #112857)

• Purpose: plasmid for the expression of a rat APOBEC1-EGFP C-terminal fusion protein
• Depositing Lab: Silvestro Conticello
• Publication: Severi et al RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Total vector size (bp): 5410
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
• Alt name: APOBEC1
• Species: R. norvegicus (rat)
• Insert Size (bp): 680
• GenBank ID: NM_012907
• Entrez Gene: Apobec1 (a.k.a. REPR, apobec-1)
• Promoter: CMV promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: TTCAGGTTCAGGGGGAGGTG

Resource Information

• Supplemental Documents:
  • APOBEC1-EGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry