Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCTD26-S>A10-17
(Plasmid #112826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112826 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJMD2
  • Backbone size w/o insert (bp) 5345
  • Total vector size (bp) 5957
  • Vector type
    Yeast Expression
  • Selectable markers
    Gentamicin, LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RPB1
  • Alt name
    RPO21
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    5200
  • Mutation
    pSMF2 with all S to A mutations in only repeats 10-17.
  • Entrez Gene
    RPO21 (a.k.a. YDL140C, RPB1, RPB220, SIT1, SUA8)
  • Promoter Native promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xma1 (not destroyed)
  • 3′ cloning site Sac1 (not destroyed)
  • 5′ sequencing primer GATCGATGAGGAGTCACTGG
  • 3′ sequencing primer TTTACTAGCGCCGTTGGTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCTD26-S>A10-17 was a gift from Stephen Fuchs (Addgene plasmid # 112826 ; http://n2t.net/addgene:112826 ; RRID:Addgene_112826)
  • For your References section:

    Repeat-Specific Functions for the C-Terminal Domain of RNA Polymerase II in Budding Yeast. Babokhov M, Mosaheb MM, Baker RW, Fuchs SM. G3 (Bethesda). 2018 May 4;8(5):1593-1601. doi: 10.1534/g3.118.200086. 10.1534/g3.118.200086 PubMed 29523636