pCTD26-S>A2-9
(Plasmid #112825)

• Purpose: pSMF2 with all S to A mutations in only repeats 2-9.
• Depositing Lab: Stephen Fuchs
• Publication: Babokhov et al G3 (Bethesda). 2018 May 4;8(5):1593-1601. doi: 10.1534/g3.118.200086.

Backbone

• Vector backbone: pJMD2
• Backbone size w/o insert (bp): 5345
• Total vector size (bp): 5957
• Vector type: Yeast Expression
• Selectable markers: Gentamicin, LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: RPB1
• Alt name: RPO21
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 5200
• Mutation: pSMF2 with all S to A mutations in only repeats 2-9.
• Entrez Gene: RPO21 (a.k.a. YDL140C, RPB1, RPB220, SIT1, SUA8)
• Promoter: Native promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xma1 (not destroyed)
• 3′ cloning site: Sac1 (not destroyed)
• 5′ sequencing primer: GATCGATGAGGAGTCACTGG
• 3′ sequencing primer: TTTACTAGCGCCGTTGGTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry