Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSMF2
(Plasmid #112819)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112819 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJMD2
  • Backbone size w/o insert (bp) 5345
  • Total vector size (bp) 5957
  • Vector type
    Yeast Expression
  • Selectable markers
    Gentamicin, LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RPB1
  • Alt name
    RPO21
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    5200
  • Entrez Gene
    RPO21 (a.k.a. YDL140C, RPB1, RPB220, SIT1, SUA8)
  • Promoter Native promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GATCGATGAGGAGTCACTGG
  • 3′ sequencing primer TTTACTAGCGCCGTTGGTTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSMF2 was a gift from Stephen Fuchs (Addgene plasmid # 112819 ; http://n2t.net/addgene:112819 ; RRID:Addgene_112819)
  • For your References section:

    DNA Instability Maintains the Repeat Length of the Yeast RNA Polymerase II C-terminal Domain. Morrill SA, Exner AE, Babokhov M, Reinfeld BI, Fuchs SM. J Biol Chem. 2016 May 27;291(22):11540-50. doi: 10.1074/jbc.M115.696252. Epub 2016 Mar 29. 10.1074/jbc.M115.696252 PubMed 27026700