pSMF2
(Plasmid
#112819)
-
PurposeExpresses wild-type Rpb1 in yeast cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJMD2
- Backbone size w/o insert (bp) 5345
- Total vector size (bp) 5957
-
Vector typeYeast Expression
-
Selectable markersGentamicin, LEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPB1
-
Alt nameRPO21
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)5200
-
Entrez GeneRPO21 (a.k.a. YDL140C, RPB1, RPB220, SIT1, SUA8)
- Promoter Native promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATCGATGAGGAGTCACTGG
- 3′ sequencing primer TTTACTAGCGCCGTTGGTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMF2 was a gift from Stephen Fuchs (Addgene plasmid # 112819 ; http://n2t.net/addgene:112819 ; RRID:Addgene_112819) -
For your References section:
DNA Instability Maintains the Repeat Length of the Yeast RNA Polymerase II C-terminal Domain. Morrill SA, Exner AE, Babokhov M, Reinfeld BI, Fuchs SM. J Biol Chem. 2016 May 27;291(22):11540-50. doi: 10.1074/jbc.M115.696252. Epub 2016 Mar 29. 10.1074/jbc.M115.696252 PubMed 27026700