Skip to main content
Addgene

pOTTC1124 - pAAV MeCP2 SpCas9(D10A)
(Plasmid #112719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112719 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pX551
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 2905
  • Total vector size (bp) 7400
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Alt name
    S. pyogenes Cas9 nuclease
  • Alt name
    Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4200
  • Mutation
    D10A
  • Promoter Mecp2

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer AATGGGGTCCGCCTCTTTTCC
  • 3′ sequencing primer cttagctggcctccacctttctcttc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1124 - pAAV MeCP2 SpCas9(D10A) was a gift from Brandon Harvey (Addgene plasmid # 112719 ; http://n2t.net/addgene:112719 ; RRID:Addgene_112719)
  • For your References section:

    Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150