Skip to main content
Addgene

pcDNA3.1-CFP-KRAS4B
(Plasmid #112717)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112717 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    ThermoFisher Scientific
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6762
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CFP-KRAS4B
  • Alt name
    cyan fluorescent protein-Kirsten ras oncogene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1317
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCCTG
  • 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CFP-KRAS4B was a gift from Kenneth Westover (Addgene plasmid # 112717 ; http://n2t.net/addgene:112717 ; RRID:Addgene_112717)
  • For your References section:

    KRAS Dimerization Impacts MEK Inhibitor Sensitivity and Oncogenic Activity of Mutant KRAS. Ambrogio C, Kohler J, Zhou ZW, Wang H, Paranal R, Li J, Capelletti M, Caffarra C, Li S, Lv Q, Gondi S, Hunter JC, Lu J, Chiarle R, Santamaria D, Westover KD, Janne PA. Cell. 2018 Feb 8;172(4):857-868.e15. doi: 10.1016/j.cell.2017.12.020. Epub 2018 Jan 11. 10.1016/j.cell.2017.12.020 PubMed 29336889