pcDNA3-bio-myc-mCE 2-210
(Plasmid
#112715)
-
PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 2-210 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 6409
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRngtt
-
Alt nameCE, mCE
-
Alt nameCapping enzyme
-
Alt nameRNA guanylyltransferase and 5'-phosphatase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)969
-
MutationSilent mutation at Arg 132 (CGT to CGC), deleted amino acids 211-597 (guanylyltransferase domain)
-
Entrez GeneRngtt (a.k.a. AU020997, HCE, MCE1)
- Promoter CMV
-
Tags
/ Fusion Proteins
- biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
- myc tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid encodes the triphosphatase domain of RNGTT.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-bio-myc-mCE 2-210 was a gift from Daniel Schoenberg (Addgene plasmid # 112715 ; http://n2t.net/addgene:112715 ; RRID:Addgene_112715) -
For your References section:
RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341