pcDNA3.1/TO-myc-BirA*-NES
(Plasmid #112714)

• Purpose: For tetracycline-inducible expression of myc-BirA*-NES in mammalian cells. For BioID studies.
• Depositing Lab: Daniel Schoenberg
• Publication: Trotman et al J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30.

Backbone

• Vector backbone: pcDNA3.1 mycBioID
• Backbone manufacturer: Addgene plasmid #35700
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 5503
• Modifications to backbone: Added TetO2 sequence at same position as in pcDNA4/TO. The HIV Rev nuclear export signal (NES) and linkers present in pcDNA3.1/TO-myc-BirA*-cCE were added downstream of the BirA* sequence.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HIV Rev nuclear export signal (NES)
• Species: human immunodeficiency virus
• Insert Size (bp): 63

Resource Information

• A portion of this plasmid was derived from a plasmid made by: BirA* sequence included in Addgene plasmid #35700 (credit to Kyle Roux).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Tet operator sequence and HIV Rev NES added to pcDNA3.1-myc-BirA* (Addgene plasmid #35700).

Peptide sequence added to the C-terminus of BirA*: LELQLPPLERLTLDMAMEA. LE and MAMEA are linker sequences in pcDNA3.1-myc-BirA*-cCE (Addgene plasmid #112713), included as a control. The LE sequence is encoded by CTCGAG, a XhoI restriction site.

Additional internal sequencing primers:
IntBirA1-F: CATTCGGAGCCAACCTGTACCTG
IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC