pcDNA3.1/TO-myc-BirA*-cCE
(Plasmid #112713)

• Purpose: For tetracycline-inducible expression of myc-BirA*-NES-mCE ΔNLS ("myc-BirA*-cCE") in mammalian cells. For BioID studies.
• Depositing Lab: Daniel Schoenberg
• Publication: Trotman et al J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30.

Backbone

• Vector backbone: pcDNA3.1 mycBioID
• Backbone manufacturer: Addgene plasmid #35700
• Backbone size w/o insert (bp): 6516
• Total vector size (bp): 8363
• Modifications to backbone: Tet operator (TO) sequence added downstream of TATA box for Tet repressor binding at an analogous position as in pcDNA4/TO. NotI restriction site changed to a BsrGI restriction site downstream of insert.
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rngtt
• Alt name: CE, mCE
• Alt name: Capping enzyme
• Alt name: RNA guanylyltransferase and 5'-phosphatase
• Species: M. musculus (mouse)
• Insert Size (bp): 1849
• Mutation: Silent mutation at Arg 132 (CGT to CGC), deleted amino acids 573-576 (KRKY nuclear localization signal)
• Entrez Gene: Rngtt (a.k.a. AU020997, HCE, MCE1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • myc tag (N terminal on backbone)
  • BirA* (BirA R118G) (N terminal on backbone)
  • HIV Rev nuclear localization signal (NES) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CMV-F (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: BGH-R (TAGAAGGCACAGTCGAGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: BirA* sequence included in Addgene plasmid #35700 (credit to Kyle Roux). Source of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Tet operator sequence added to pcDNA3.1-myc-BirA*-cCE, originally described in Trotman et al. 2017 (10.1093/nar/gkx801)

Additional internal sequencing primers:
IntBirA1-F: CATTCGGAGCCAACCTGTACCTG
IntBirA2-F: CGACAAGGAAATCTTCGGCATCTCC
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC