pcDNA4/TO-bio-myc-cCE
(Plasmid
#112711)
-
PurposeFor tetracycline-inducible expression of bio-myc-NES-mCE ΔNLS ("bio-myc-cCE") in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5078
- Total vector size (bp) 7203
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRngtt
-
Alt nameCE, mCE
-
Alt nameCapping enzyme
-
Alt nameRNA guanylyltransferase and 5'-phosphatase
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2189
-
MutationSilent mutation at Arg 132 (CGT to CGC), deleted amino acids 573-576 (KRKY nuclear localization signal)
-
Entrez GeneRngtt (a.k.a. AU020997, HCE, MCE1)
- Promoter CMV with Tet repressor binding sites
-
Tags
/ Fusion Proteins
- biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
- myc tag (N terminal on insert)
- HIV Rev nuclear localization signal (NES) (N terminal on insert)
- Stop codon followed by an out-of-frame FLAG tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer pcDNA4TO-CMV-F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer pcDNA4TO-R (AGCATGCCTGCTATTGTCTTCCCA) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource of Rngtt sequence: pCR21-mCE, provided by Aaron Shatkin, Rutgers University
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information about this plasmid, see Mukherjee et al. 2014 PLoS Biol (10.1371/journal.pbio.1001933). The insert sequence of this plasmid was subcloned from pcDNA3-bio-myc-NES-mCEΔNLS described in this publication.
Additional internal sequencing primers:
IntCE1-F: GAATGCCCCACCACTGAGAATACTG
IntCE2-F: GTTAGGAGAGGTGCAGCAGAAATGTC
IntCE3-F: CAAAGAAGTCAGCCATGAAATGGATGGAC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA4/TO-bio-myc-cCE was a gift from Daniel Schoenberg (Addgene plasmid # 112711 ; http://n2t.net/addgene:112711 ; RRID:Addgene_112711) -
For your References section:
RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341