pHES945
(Plasmid
#112643)
-
Purposeblue light inducible cryptochrome based optogenetic expression system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSV605
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 10200
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRY2PHR-GAL4DBD
-
SpeciesS. cerevisiae (budding yeast), A. thaliana (mustard weed)
- Promoter TDH3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CTATATTAGCTTGTGCATTCGCATG
- 3′ sequencing primer ATC GCA CTC ACG TAA ACA CTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHES945 was a gift from Hana El-Samad (Addgene plasmid # 112643 ; http://n2t.net/addgene:112643 ; RRID:Addgene_112643) -
For your References section:
Real-Time Genetic Compensation Defines the Dynamic Demands of Feedback Control. Harrigan P, Madhani HD, El-Samad H. Cell. 2018 Oct 18;175(3):877-886.e10. doi: 10.1016/j.cell.2018.09.044. 10.1016/j.cell.2018.09.044 PubMed 30340045