pEHC_PGKneoLox2DTA.2
(Plasmid
#112623)
-
PurposeH2BEmerald_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology arms
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePGKneoLox2DTA.2
-
Backbone manufacturerP. Soriano Addgene Plasmid 13449
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 11237
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418), Hygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameH2B-Emerald
-
Alt nameHIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
-
SpeciesH. sapiens (human); Aequorea victoria
-
Insert Size (bp)1101
-
GenBank IDNM_021058
-
Entrez GeneH2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
- Promoter No Promoter
-
Tag
/ Fusion Protein
- Emerald (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTATTCATGAGGCCGGCCACC
- 3′ sequencing primer TGAAGTTAGTAGCTCCGCTTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHygrophosphotransferase
-
Alt nameHygroR
-
Alt namehygromycin-B
-
SpeciesCoccidioides posadasii C735 delta SOWgp
-
Insert Size (bp)1023
-
GenBank IDXM_003071606
- Promoter No Promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaaaaagcctgaactcaccgc
- 3′ sequencing primer ttcctttgccctcggacga (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCre-ERT2 fusion protein
-
SpeciesBacteriophage P1
-
Insert Size (bp)1983
- Promoter No Promoter
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCCAATTTACTGACCGTACA
- 3′ sequencing primer TCAAGCTGTGGCAGGGAAACC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byH2B was cloned from Addgene plasmid 26750, Emerald was cloned from Addgene plasmid 53976, HygroR was cloned from Addgene plasmid 28226, CreERT2 and Rabbit betaglobin PolyA were cloned from Addgene plasmid 14797, PGKneoLox2DTA.2 backbone was cloned from Addgene plasmid 13449
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEHC_PGKneoLox2DTA.2 was a gift from Stefan Heller (Addgene plasmid # 112623 ; http://n2t.net/addgene:112623 ; RRID:Addgene_112623) -
For your References section:
Fbxo2(VHC) mouse and embryonic stem cell reporter lines delineate in vitro-generated inner ear sensory epithelia cells and enable otic lineage selection and Cre-recombination. Hartman BH, Bscke R, Ellwanger DC, Keymeulen S, Scheibinger M, Heller S. Dev Biol. 2018 Sep 1. pii: S0012-1606(18)30499-8. doi: 10.1016/j.ydbio.2018.08.013. 10.1016/j.ydbio.2018.08.013 PubMed 30179592