Skip to main content
Addgene

pEHC
(Plasmid #112615)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112615 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    promoterless backbone from pd2EGFP-1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3110
  • Total vector size (bp) 8129
  • Vector type
    Mammalian Expression ; Promoterless vector, ready for promoter for mammalian expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    H2B-Emerald
  • Alt name
    HIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
  • Species
    H. sapiens (human); Aequorea victoria
  • Insert Size (bp)
    1101
  • GenBank ID
    NM_021058
  • Entrez Gene
    H2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
  • Promoter No Promoter
  • Tag / Fusion Protein
    • Emerald (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAAGAATTCATGAGGCCGGCC
  • 3′ sequencing primer TGAAGTTAGTAGCTCCGCTTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Hygrophosphotransferase
  • Alt name
    HygroR
  • Alt name
    hygromycin-B
  • Species
    Coccidioides posadasii C735 delta SOWgp
  • Insert Size (bp)
    1023
  • GenBank ID
    XM_003071606
  • Promoter No Promoter

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgaaaaagcctgaactcaccgc
  • 3′ sequencing primer ttcctttgccctcggacga
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Cre-ERT2 fusion protein
  • Species
    Bacteriophage P1
  • Insert Size (bp)
    1983
  • Promoter No Promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGTCCAATTTACTGACCGTACA
  • 3′ sequencing primer TCAAGCTGTGGCAGGGAAACC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    H2B was cloned from Addgene plasmid 26750, Emerald was cloned from Addgene plasmid 53976, HygroR was cloned from Addgene plasmid 28226, CreERT2 and Rabbit betaglobin PolyA were cloned from Addgene plasmid 14797

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Promoterless multicistronic reporter plasmid containing H2BEmerald, HygroR, and CreERT2 in a single ORF with two P2A sequences.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEHC was a gift from Stefan Heller (Addgene plasmid # 112615 ; http://n2t.net/addgene:112615 ; RRID:Addgene_112615)
  • For your References section:

    Fbxo2(VHC) mouse and embryonic stem cell reporter lines delineate in vitro-generated inner ear sensory epithelia cells and enable otic lineage selection and Cre-recombination. Hartman BH, Bscke R, Ellwanger DC, Keymeulen S, Scheibinger M, Heller S. Dev Biol. 2018 Sep 1. pii: S0012-1606(18)30499-8. doi: 10.1016/j.ydbio.2018.08.013. 10.1016/j.ydbio.2018.08.013 PubMed 30179592