-
PurposeExpresses 10xHis-MBP fused to Cas14b1 under t7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMBP
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas14b1
-
Insert Size (bp)1524
- Promoter T7
-
Tag
/ Fusion Protein
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGCAG
- 3′ sequencing primer CTA GTT ATT GCT CAG CGG T (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLBH532_MBP-Cas14b1 expression was a gift from Jennifer Doudna (Addgene plasmid # 112505 ; http://n2t.net/addgene:112505 ; RRID:Addgene_112505) -
For your References section:
Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA. Science. 2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294. 10.1126/science.aav4294 PubMed 30337455