-
PurposeExpresses 10xHis-Cas14a1 locus (including crRNA and tracrRNA) under control of a tetracycline inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112502 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTet
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas14a1
-
Alt nameUn1Cas12f1
-
Insert Size (bp)2181
- Promoter Tet
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgccgatcaacgtAtcattttcg
- 3′ sequencing primer acgcagaaaggcccacccgaag (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLBH559_Tet-HisCas14a1Locus was a gift from Jennifer Doudna (Addgene plasmid # 112502 ; http://n2t.net/addgene:112502 ; RRID:Addgene_112502) -
For your References section:
Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA. Science. 2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294. 10.1126/science.aav4294 PubMed 30337455