CLYBL hOPM
(Plasmid #112499)

• Purpose: Homologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in CLYBL locus
• Depositing Lab: Bruce Conklin
• Publication: TF-induced RPE (unpublished)

Backbone

• Vector backbone: F8 CLYBL
• Backbone size w/o insert (bp): 10571
• Total vector size (bp): 14459
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OTX2, PAX6, MITF
• Species: H. sapiens (human)
• Insert Size (bp): 3888
• Entrez Gene: PAX6 (a.k.a. AN, AN1, AN2, ASGD5, D11S812E, FVH1, MGDA, WAGR)
• Entrez Gene: MITF (a.k.a. CMM8, COMMAD, MI, MITF-A, WS2, WS2A, bHLHe32)
• Entrez Gene: OTX2 (a.k.a. CPHD6, MCOPS5)
• Promoter: TRE3G

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG

Resource Information

• Supplemental Documents:
  • CLYBL hOPM.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry