Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUWL201PW-creDE
(Plasmid #112241)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUWL201PW
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Streptomyces/E. coli shuttle vector. Ampicillin in E. coli. Thiostrepton in Streptomyces.
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    creD
  • GenBank ID
    ALA99201.1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GCACGCGGTCGATCTTGACGGCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    creE
  • GenBank ID
    ALA99202.1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer GCACGCGGTCGATCTTGACGGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUWL201PW-creDE was a gift from Emily Balskus (Addgene plasmid # 112241 ; http://n2t.net/addgene:112241 ; RRID:Addgene_112241)
  • For your References section:

    Discovery of a Diazo-Forming Enzyme in Cremeomycin Biosynthesis. Waldman AJ, Balskus EP. J Org Chem. 2018 May 29. doi: 10.1021/acs.joc.8b00367. 10.1021/acs.joc.8b00367 PubMed 29771512