pUWL201PW-creDE
(Plasmid #112241)

• Purpose: Streptomyces/E.coli shuttle expression vector encoding creD and creE
• Depositing Lab: Emily Balskus
• Publication: Waldman et al J Org Chem. 2018 May 29. doi: 10.1021/acs.joc.8b00367.

Backbone

• Vector backbone: pUWL201PW
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Streptomyces/E. coli shuttle vector. Ampicillin in E. coli. Thiostrepton in Streptomyces.
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: creD
• GenBank ID: ALA99201.1

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: GCACGCGGTCGATCTTGACGGCT

Gene/Insert 2

• Gene/Insert name: creE
• GenBank ID: ALA99202.1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: GCACGCGGTCGATCTTGACGGCT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry