pUWL201PW-creM-N-His6
(Plasmid
#112240)
-
PurposeStreptomyces/E.coli shuttle expression vector encoding an N-terminal N-His6 tagged CreM
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUWL201PW
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStreptomyces/E. coli shuttle vector. Ampicillin in E. coli. Thiostrepton in Streptomyces.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecreM
-
GenBank IDALA99210.1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GCACGCGGTCGATCTTGACGGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUWL201PW-creM-N-His6 was a gift from Emily Balskus (Addgene plasmid # 112240 ; http://n2t.net/addgene:112240 ; RRID:Addgene_112240) -
For your References section:
Discovery of a Diazo-Forming Enzyme in Cremeomycin Biosynthesis. Waldman AJ, Balskus EP. J Org Chem. 2018 May 29. doi: 10.1021/acs.joc.8b00367. 10.1021/acs.joc.8b00367 PubMed 29771512