pBS-I-Sce1-eno2:Tau-IRES-egfp
(Plasmid #112205)

• Purpose: Used to make transgenic zebrafish expressing human 4R/0N Tau under the neuronal eno2 promoter
• Depositing Lab: Edward Burton
• Publication: Bai et al Nucleic Acids Res. 2007;35(19):6501-16. Epub 2007 Sep 25.

Backbone

• Vector backbone: pBlueScript-ISce1
• Total vector size (bp): 16000
• Vector type: zebrafish expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: MAPT
• Alt name: Tau
• Species: H. sapiens (human)
• Entrez Gene: MAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
• Promoter: eno2 from zebrafish
• Tag / Fusion Protein:
  • eno2 exon 2 translational fusion, ires-egfp at c terminal

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGGCTTTGCTCTTATCCAAT
• 3′ sequencing primer: TACAAATGTGGTATGGCTGA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: MAPT cDNA from Matt Farrer at Mayo Jacksonville

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry