MCV-HF LTS220A/S239A
(Plasmid
#112191)
-
PurposeMerkel cell polyomavirus molecular clone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJ241
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 2755
- Total vector size (bp) 8142
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCV-HF LTS220A/S239A
-
SpeciesMerkel cell polyomavirus
-
Insert Size (bp)5387
-
MutationT to G mutations at 3313 (nt) and 3370 (nt) of full construct
-
GenBank IDJF813003
- Promoter None from vector. Insert contains native promoter from viral genome encompassed in the viral non-coding control region.
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTGATTATCTTAGCCATGCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCV-HF LTS220A/S239A was a gift from Patrick Moore (Addgene plasmid # 112191 ; http://n2t.net/addgene:112191 ; RRID:Addgene_112191) -
For your References section:
Protein-mediated viral latency is a novel mechanism for Merkel cell polyomavirus persistence. Kwun HJ, Chang Y, Moore PS. Proc Natl Acad Sci U S A. 2017 May 16;114(20):E4040-E4047. doi: 10.1073/pnas.1703879114. Epub 2017 May 1. 10.1073/pnas.1703879114 PubMed 28461484