pcDNA3.1 SP-His-mCherry-HRP-VhHGFP
(Plasmid #112157)

• Purpose: Expression and secretion of anti-GFP FLIPPER-bodies, small protein probes for correlated microscopy. FLIPPER-bodies are the fusion of a nanobody with a fluorescent protein and a peroxidase.
• Depositing Lab: Ben Giepmans
• Publication: de Beer et al Histochem Cell Biol. 2018 Mar;149(3):261-268. doi: 10.1007/s00418-018-1632-6. Epub 2018 Jan 11.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5371
• Total vector size (bp): 7528
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: anti-GFP FLIPPER-body
• Species: Synthetic
• Insert Size (bp): 2157
• Promoter: CMV
• Tags / Fusion Proteins:
  • His (N terminal on insert)
  • Thrombin cleavage site (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGGA
• 3′ sequencing primer: TGGCAACTAGAAGGCACAGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: mCherry was directly derived from the Roger Tsien lab (Shaner et al. 2004) and is available via Addgene. Nanobody against GFP was from Addgene. HRP was amplified from FLIPPER (Kuipers et al. 2015), the original cDNA was provided by R.S. Lewis (Luik et al. 2006).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry