Skip to main content
Addgene

pLL6 sgRNA(MS2)-MS2-hA3a D131E
(Plasmid #112132)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112132 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Zhang lab (Addgene plasmid #42230)
  • Backbone size w/o insert (bp) 7184
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Apobec3a D131E mutant
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    D131E mutant in hA3a
  • Entrez Gene
    APOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
  • Promoter hU6,CBh

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATCGCCGCTAACTCAGGTAT
  • 3′ sequencing primer GGGAGGGGCAAACAACAGAT
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL6 sgRNA(MS2)-MS2-hA3a D131E was a gift from Fei-Long Meng (Addgene plasmid # 112132 ; http://n2t.net/addgene:112132 ; RRID:Addgene_112132)

  • For your References section:

    Intrinsic Nucleotide Preference of Diversifying Base Editors Guides Antibody Ex Vivo Affinity Maturation. Liu LD, Huang M, Dai P, Liu T, Fan S, Cheng X, Zhao Y, Yeap LS, Meng FL. Cell Rep. 2018 Oct 23;25(4):884-892.e3. doi: 10.1016/j.celrep.2018.09.090. 10.1016/j.celrep.2018.09.090 PubMed 30355495
Related items:
Commonly requested with: