Skip to main content
Addgene

pPagP
(Plasmid #112125)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112125 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET11A
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6130
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    protein expresses into inclusion bodies
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PagP
  • Alt name
    Lipid IVA palmitoyltransferase
  • Species
    E. coli
  • Insert Size (bp)
    486
  • Mutation
    N-terminal signal sequence not included and replaced with Methionine
  • Entrez Gene
    pagP (a.k.a. b0622, ECK0615, crcA, ybeG)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site nde1 (not destroyed)
  • 3′ cloning site bamh1 (not destroyed)
  • 5′ sequencing primer GCTACATATGAACGCAGATGAGTGGAT or T7
  • 3′ sequencing primer GGCGGATCCTCAAAACTGAAAGCGCATCC or T7 terminal
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPagP was a gift from Karen Fleming (Addgene plasmid # 112125 ; http://n2t.net/addgene:112125 ; RRID:Addgene_112125)

  • For your References section:

    Beta-barrel proteins that reside in the Escherichia coli outer membrane in vivo demonstrate varied folding behavior in vitro. Burgess NK, Dao TP, Stanley AM, Fleming KG. J Biol Chem. 2008 Sep 26;283(39):26748-58. doi: 10.1074/jbc.M802754200. Epub 2008 Jul 19. 10.1074/jbc.M802754200 PubMed 18641391
Related items: