Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOmpT
(Plasmid #112123)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112123 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET11A
  • Backbone size w/o insert (bp) 5636
  • Total vector size (bp) 6530
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Expressed protein ends up in inclusion bodies
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OmpT
  • Alt name
    outer membrane protease T
  • Species
    E. coli
  • Insert Size (bp)
    894
  • Mutation
    N-terminal signal sequence not included and replaced with Methionine.
  • GenBank ID
    NC_000913.3
  • Entrez Gene
    ompT (a.k.a. b0565, ECK0557)
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site nde1 (not destroyed)
  • 3′ cloning site bamh1 (not destroyed)
  • 5′ sequencing primer GCTACATATGTCTACCGAGACTTTATCG or T7
  • 3′ sequencing primer GGCGGATCCTTAAAATGTGTACTTAAGACCAGCAG or T7 terminal
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOmpT was a gift from Karen Fleming (Addgene plasmid # 112123 ; http://n2t.net/addgene:112123 ; RRID:Addgene_112123)
  • For your References section:

    Beta-barrel proteins that reside in the Escherichia coli outer membrane in vivo demonstrate varied folding behavior in vitro. Burgess NK, Dao TP, Stanley AM, Fleming KG. J Biol Chem. 2008 Sep 26;283(39):26748-58. doi: 10.1074/jbc.M802754200. Epub 2008 Jul 19. 10.1074/jbc.M802754200 PubMed 18641391