pOmpW
(Plasmid #112121)

• Purpose: Bacterial expression of outer membrane protein W (OmpW), wild type
• Depositing Lab: Karen Fleming
• Publication: Burgess et al J Biol Chem. 2008 Sep 26;283(39):26748-58. doi: 10.1074/jbc.M802754200. Epub 2008 Jul 19.

Backbone

• Vector backbone: pET11A
• Backbone size w/o insert (bp): 5600
• Total vector size (bp): 6216
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: expressed protein goes to inclusion bodies
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OmpW
• Alt name: Outer Membrane protein W
• Species: E. coli
• Insert Size (bp): 577
• Mutation: N-terminal signal sequence not included and replaced with Methionine.
• Entrez Gene: ompW (a.k.a. b1256, ECK1250, yciD)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: nde1 (not destroyed)
• 3′ cloning site: BamH1 (not destroyed)
• 5′ sequencing primer: GCTACATATGCATGAAGCAGGCGAATTT or T7
• 3′ sequencing primer: GGCGGATCCTTAAAAACGATATCCTGCTGAG or T7 terminator

Resource Information

• Supplemental Documents:
  • pET11a-OmpW-1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry