pcDNA3.1(+)-NES-ZapCV2 (cpV143)
(Plasmid #112060)

• Purpose: Genetically-encoded Cyan-Yellow Zinc FRET sensor. Localizes to the cytosol. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)
• Depositing Lab: Amy Palmer
• Publication: Fiedler et al Anal Chem. 2017 Jan 3;89(1):711-719. doi: 10.1021/acs.analchem.6b03235. Epub 2016 Dec 13.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone manufacturer: Invitrogen (ThermoFisher / Life Technologies)
• Backbone size w/o insert (bp): 5428
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Depositing lab uses Omnimax cells.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-ZapCV2
• Species: Synthetic
• Insert Size (bp): 1693
• Mutation: ECFP gene is truncated 36 bp at 3' end. Venus gene is circurlarly permuted at residue 173. Zap2 zinc binding domain derived from S. cerevisiae Zap1 zinc finger domains 1 & 2 with C581H and C618H mutations.
• Promoter: CMV
• Tag / Fusion Protein:
  • Nuclear Export Signal (NES) derived from HIV-1 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: Quintara Bio: CMV Forward (5'-CGCAAATGGGCGGTAGGCGTG-3')
• 3′ sequencing primer: Quintara Bio: L-12EndR (5'- GGAAAGGACAGTGGGAGTGG -3')

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry