pJW1663
(Plasmid
#112037)
-
PurposeGal-Estradiol transcription activation expression cassette marked with KanR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS316
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGal DNA binding-estradiol binding-MSN2 activator
- Promoter ADH1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATCTCCCTATCAGTGATAGAG
- 3′ sequencing primer caagctgtgaccgtctcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1663 was a gift from Jonathan Weissman (Addgene plasmid # 112037 ; http://n2t.net/addgene:112037 ; RRID:Addgene_112037) -
For your References section:
Defining the physiological role of SRP in protein-targeting efficiency and specificity. Costa EA, Subramanian K, Nunnari J, Weissman JS. Science. 2018 Jan 18. pii: science.aar3607. doi: 10.1126/science.aar3607. 10.1126/science.aar3607 PubMed 29348368