Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJW1663
(Plasmid #112037)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112037 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS316
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Gal DNA binding-estradiol binding-MSN2 activator
  • Promoter ADH1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GATCTCCCTATCAGTGATAGAG
  • 3′ sequencing primer caagctgtgaccgtctcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1663 was a gift from Jonathan Weissman (Addgene plasmid # 112037 ; http://n2t.net/addgene:112037 ; RRID:Addgene_112037)
  • For your References section:

    Defining the physiological role of SRP in protein-targeting efficiency and specificity. Costa EA, Subramanian K, Nunnari J, Weissman JS. Science. 2018 Jan 18. pii: science.aar3607. doi: 10.1126/science.aar3607. 10.1126/science.aar3607 PubMed 29348368