pHvL1P4GA
(Plasmid
#112028)
-
PurposeExpresses sgRNA in barley
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
-
Backbone manufacturerUnknown
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4500
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTaU6-LacZ-sgRNA
-
gRNA/shRNA sequenceTo be inserted
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAGGAGGGAATCGAACTAGGAATATTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHvL1P4GA was a gift from Wendy Harwood (Addgene plasmid # 112028 ; http://n2t.net/addgene:112028 ; RRID:Addgene_112028) -
For your References section:
Creating Targeted Gene Knockouts in Barley Using CRISPR/Cas9. Lawrenson T, Harwood WA. Methods Mol Biol. 2019;1900:217-232. doi: 10.1007/978-1-4939-8944-7_14. 10.1007/978-1-4939-8944-7_14 PubMed 30460568