Skip to main content
Addgene

NYESO beta into TRBC1 HDRT Source (pTR 277)
(Plasmid #112024)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112024 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NYESO beta into TRBC1 HDRT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1247

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA sequence that can be used with this DNA template: CAAACACAGCGACCTTGGGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NYESO beta into TRBC1 HDRT Source (pTR 277) was a gift from Alexander Marson (Addgene plasmid # 112024 ; http://n2t.net/addgene:112024 ; RRID:Addgene_112024)
  • For your References section:

    Reprogramming human T cell function and specificity with non-viral genome targeting. Roth TL, Puig-Saus C, Yu R, Shifrut E, Carnevale J, Li PJ, Hiatt J, Saco J, Krystofinski P, Li H, Tobin V, Nguyen DN, Lee MR, Putnam AL, Ferris AL, Chen JW, Schickel JN, Pellerin L, Carmody D, Alkorta-Aranburu G, Del Gaudio D, Matsumoto H, Morell M, Mao Y, Cho M, Quadros RM, Gurumurthy CB, Smith B, Haugwitz M, Hughes SH, Weissman JS, Schumann K, Esensten JH, May AP, Ashworth A, Kupfer GM, Greeley SAW, Bacchetta R, Meffre E, Roncarolo MG, Romberg N, Herold KC, Ribas A, Leonetti MD, Marson A. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0326-5. doi: 10.1038/s41586-018-0326-5. 10.1038/s41586-018-0326-5 PubMed 29995861