Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJB03
(Plasmid #111961)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111961 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMal
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 6700
  • Total vector size (bp) 7926
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mEGFP
  • Alt name
    GFP
  • Insert Size (bp)
    717
  • Mutation
    enhanced GFP with monomerizing A206K mutation
  • Promoter Tac
  • Tag / Fusion Protein
    • DHFR (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GGGTGGTGCCCATCCTGG
  • 3′ sequencing primer CTTGTACAGCTCGTCCATGCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    eDHFR
  • Alt name
    Dehydrofolate reductase; DHFR
  • Species
    E. Coli
  • Insert Size (bp)
    474
  • Mutation
    eDHFR;residues 2-159

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATCAGTCTGATTGCGGCG
  • 3′ sequencing primer CCGCCGCTCCAGAATCTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJB03 was a gift from Matthew Good (Addgene plasmid # 111961 ; http://n2t.net/addgene:111961 ; RRID:Addgene_111961)
  • For your References section:

    Optochemical Control of Protein Localization and Activity within Cell-like Compartments. Caldwell RM, Bermudez JG, Thai D, Aonbangkhen C, Schuster BS, Courtney T, Deiters A, Hammer DA, Chenoweth DM, Good MC. Biochemistry. 2018 May 8;57(18):2590-2596. doi: 10.1021/acs.biochem.8b00131. Epub 2018 Apr 19. 10.1021/acs.biochem.8b00131 PubMed 29671583