pEGFP-N1-STAT3
(Plasmid #111934)

• Purpose: Expresses human STAT3 fused to GFP in mammalian cells
• Depositing Lab: Geert van den Bogaart
• Publication: Verboogen et al J Mol Cell Biol. 2018 Jul 16. pii: 5054600. doi: 10.1093/jmcb/mjy038.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Signal transducer and activator of transcription 3
• Alt name: STAT3
• Alt name: APRF
• Species: H. sapiens (human)
• Insert Size (bp): 2336
• GenBank ID: NM_139276.2
• Entrez Gene: STAT3 (a.k.a. ADMIO, ADMIO1, APRF, HIES)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: TAACAACTCCGCCCCATT
• 3′ sequencing primer: GTCCAGCTCGACCAGGATGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthetic gene from Genscript
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry